Thông tin chung
  English
  Đề tài NC khoa học
  Bài báo, báo cáo khoa học
  Hướng dẫn Sau đại học
  Sách và giáo trình
  Các học phần và môn giảng dạy
  Giải thưởng khoa học, Phát minh, sáng chế
  Khen thưởng
  Thông tin khác
  Tài liệu tham khảo
  Hiệu chỉnh
 
Số người truy cập: 107,416,973

 RESEARCH ON THE DETECTION OF HELICOBACTER PYLORI IN SALIVA OF GASTRITIS AND DUODENITIS PATIENTS BY REAL-TIME PCR TECHNIQUE
Tác giả hoặc Nhóm tác giả: Do Hoang Long1*, Nguyen Thanh Nam2 , Hoang Duc Trinh1 , Trinh Thi Hong Cua1 , Dinh Thi Huong Truc1 , Le Chi Dung1 1. Can Tho University of Medicine and Pharmacy 2. School of Medicine and Pharmacy - University of Da Nang *Corresponding author: dhlong@ctump.edu.vn
Nơi đăng: Can Tho Journal of Medicine and Pharmacy; Số: 9(6);Từ->đến trang: 29-34;Năm: 2023
Lĩnh vực: Chưa xác định; Loại: Bài báo khoa học; Thể loại: Trong nước
TÓM TẮT
ABSTRACT
ABSTRACT Background: Helicobacter pylori plays an important role in the etiology and pathogenesis of gastritis and duodenitis. There are two groups of test methods to detect Helicobacter pylori infection: invasive methods and non-invasive methods. Testing for Helicobacter pylori in saliva by real-time PCR technique belongs to group of non-invasive test methods. Objectives: To determine the detection rate of Helicobacter pylori in saliva by real-time PCR technique in gastritis and duodenitis patients and to investigate some factors related to Helicobacter pylori infection detected in saliva using real-time PCR technique in gastritis and duodenitis. Materials and method: A cross-sectional descriptive study on 91 patients after convenient sampling was preliminarily diagnosed with gastritis and duodenitis with indications for endoscopy and biopsy. Biopsy specimens were used for urease and histopathology tests. Saliva is taken directly from the mouth after spitting into a dedicated bottle and conducting a real-time PCR test. Gene amplification will be performed with a PYLORI-PCR mix containing primers and for the expected target product of 203 base pairs length: 5' - AGCGCTCTCACTTCCATAGGC - 3' and 5' - Can Tho Journal of Medicine and Pharmacy 9(6) (2023) 30 TCTTCGGTTAAAAAAGCGAT - 3'. Install the program "Protocol" for the Real-time PCR machine to operate with the following cycles: 1 cycle: 950C for 5 minutes; 40 cycles: 950C for 15 seconds, 550C for 1 minute and 720C for 20 seconds. Results: The positive rate for Helicobacter pylori in saliva by realtime PCR technique, urease test and histopathology were 20.9%, 19.8% and 46.2% respectively. The detection rate of H. pylori by real-time PCR in saliva and the detection rate on urease test as well as histopathology had a statistically significant correlation. A few important factors related to Helicobacter pylori-positive patients in saliva as follows: personal history suffer from gastritis and duodenitis 40.7%, reflux esophagitis 67%, and congestive inflammation 75.8%. Conclusions: The rate of detecting Helicobacter pylori in saliva by real-time PCR technique in gastritis and duodenitis patients in Can Tho University of Medicine and Pharmacy Hospital is higher than urease test and lower
[ 2023\2023m012d05_14_59_425-2156-9966_Van_ban_cua_bai_bao.pdf ]
© Đại học Đà Nẵng
 
 
Địa chỉ: 41 Lê Duẩn Thành phố Đà Nẵng
Điện thoại: (84) 0236 3822 041 ; Email: dhdn@ac.udn.vn